Table Info

Name	PCR product (bp)	Primer sequence
Cdh2	426	Forward: AGCTGACCAACCTCCAACAG Reverse: TGTACTTTCTCTCTGTCGAGCC
Cdh6B	269	Forward: CCCCCAGAGCACCTACCAAT Reverse: ATCGAGGGTCCACGTGAGTA
Cdh7	319	Forward: GACCCTTCAGCGACATGACA Reverse: TGTGCTGGATTCTGACTCTCC
Cdh8	289	Forward: TGGTGATTTGCGTAGCTTGTG Reverse: TCTGTATGTAACCGGCCAACT

Supplementary materials

The supplementary figure for this article is available at: https://www.explorationpub.com/uploads/Article/file/101335_sup_1.pdf.

Declarations

Acknowledgements

The co-authors thank Ms. Larissa Oprysk for her contributions to the development of figures.

Author contributions

ACD, ARL, BR: Validation, Writing—review & editing. RR: Data curation. LC: Conceptualization, Writing—review & editing. MV: Conceptualization, Supervision, Writing—original draft, Writing—review & editing. All authors read and approved the submitted version.

Conflicts of interest

The authors declare that they have no conflicts of interest.

Ethical approval

All of the animal experiments were waived by the Institutional Animal Care and Facilities Committee at Rutgers University. Chick embryos up to embryonic day 18 (E18) are not considered vertebrates by the Institutional Animal Care and Facilities Committee (IACUC) at Rutgers University. Thus, the embryos (E1–E12) studied in this project are not subject to IACUC approval.

Consent to participate

Not applicable.

Consent to publication

Not applicable.

Availability of data and materials

The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.

Funding

This work was supported by the National Institutes of Health [R21 EY031439-01]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright

Publisher’s note

Open Exploration maintains a neutral stance on jurisdictional claims in published institutional affiliations and maps. All opinions expressed in this article are the personal views of the author(s) and do not represent the stance of the editorial team or the publisher.

References

GBD 2019 Blindness and Vision Impairment Collaborators; Vision Loss Expert Group of the Global Burden of Disease Study. Causes of blindness and vision impairment in 2020 and trends over 30 years, and prevalence of avoidable blindness in relation to VISION 2020: the Right to Sight: an analysis for the Global Burden of Disease Study. Lancet Glob Health. 2021;9:e144–60. [DOI] [PubMed] [PMC]

Teo ZL, Tham Y, Yu M, Chee ML, Rim TH, Cheung N, et al. Global Prevalence of Diabetic Retinopathy and Projection of Burden through 2045: Systematic Review and Meta-analysis. Ophthalmology. 2021;128:1580–91. [DOI] [PubMed]

Van Gelder RN, Chiang MF, Dyer MA, Greenwell TN, Levin LA, Wong RO, et al. Regenerative and restorative medicine for eye disease. Nat Med. 2022;28:1149–56. [DOI] [PubMed] [PMC]

Lin KT, Wang A, Nguyen AB, Iyer J, Tran SD. Recent Advances in Hydrogels: Ophthalmic Applications in Cell Delivery, Vitreous Substitutes, and Ocular Adhesives. Biomedicines. 2021;9:1203. [DOI] [PubMed] [PMC]

Dromel PC, Singh D, Andres E, Likes M, Kurisawa M, Alexander-Katz A, et al. A bioinspired gelatin-hyaluronic acid-based hybrid interpenetrating network for the enhancement of retinal ganglion cells replacement therapy. NPJ Regen Med. 2021;6:85. [DOI] [PubMed] [PMC]

Jemni-Damer N, Guedan-Duran A, Cichy J, Lozano-Picazo P, Gonzalez-Nieto D, Perez-Rigueiro J, et al. First steps for the development of silk fibroin-based 3D biohybrid retina for age-related macular degeneration (AMD). J Neural Eng. 2020;17:055003. [DOI] [PubMed]

Kundu J, Michaelson A, Talbot K, Baranov P, Young MJ, Carrier RL. Decellularized retinal matrix: Natural platforms for human retinal progenitor cell culture. Acta Biomater. 2016;31:61–70. [DOI] [PubMed]

Li G, Liu S, Chen W, Jiang Z, Luo Y, Wang D, et al. Acellularized Uvea Hydrogel as Novel Injectable Platform for Cell-Based Delivering Treatment of Retinal Degeneration and Optimizing Retinal Organoids Inducible System. Adv Healthc Mater. 2022;11:e2202114. [DOI] [PubMed]

Sasseville S, Karami S, Tchatchouang A, Charpentier P, Anney P, Gobert D, et al. Biomaterials used for tissue engineering of barrier-forming cell monolayers in the eye. Front Bioeng Biotechnol. 2023;11:1269385. [DOI] [PubMed] [PMC]

10.

Nair DSR, Seiler MJ, Patel KH, Thomas V, Camarillo JCM, Humayun MS, et al. Tissue Engineering Strategies for Retina Regeneration. Appl Sci (Basel). 2021;11:2154. [DOI] [PubMed] [PMC]

11.

Lee I, Xie R, Luz-Madrigal A, Min S, Zhu J, Jin J, et al. Micromolded honeycomb scaffold design to support the generation of a bilayered RPE and photoreceptor cell construct. Bioact Mater. 2023;30:142–53. [DOI] [PubMed] [PMC]

12.

Soucy JR, Aguzzi EA, Cho J, Gilhooley MJ, Keuthan C, Luo Z, et al. Retinal ganglion cell repopulation for vision restoration in optic neuropathy: a roadmap from the RReSTORe Consortium. Mol Neurodegener. 2023;18:64. [DOI] [PubMed] [PMC]

13.

Stone NE, Voigt AP, Mullins RF, Sulchek T, Tucker BA. Microfluidic processing of stem cells for autologous cell replacement. Stem Cells Transl Med. 2021;10:1384–93. [DOI] [PubMed] [PMC]

14.

Quinn J, Musa A, Kantor A, McClements ME, Cehajic-Kapetanovic J, MacLaren RE, et al. Genome-Editing Strategies for Treating Human Retinal Degenerations. Hum Gene Ther. 2021;32:247–59. [DOI] [PubMed] [PMC]

15.

Hunt NC, Hallam D, Chichagova V, Steel DH, Lako M. The Application of Biomaterials to Tissue Engineering Neural Retina and Retinal Pigment Epithelium. Adv Healthc Mater. 2018;7:e1800226. [DOI] [PubMed]

16.

Markey M, Vazquez M. Targeting collective behaviors of transplanted retinal cells as a strategy to improve cellular integration. Neural Regen Res. 2022;17:1271–2. [DOI] [PubMed] [PMC]

17.

Warre-Cornish K, Barber AC, Sowden JC, Ali RR, Pearson RA. Migration, integration and maturation of photoreceptor precursors following transplantation in the mouse retina. Stem Cells Dev. 2014;23:941–54. [DOI] [PubMed] [PMC]

18.

Thakur A, Mishra S, Pena J, Zhou J, Redenti S, Majeska R, et al. Collective adhesion and displacement of retinal progenitor cells upon extracellular matrix substrates of transplantable biomaterials. J Tissue Eng. 2018;9:2041731417751286. [DOI] [PubMed] [PMC]

19.

McCutcheon S, Unachukwu U, Thakur A, Majeska R, Redenti S, Vazquez M. In vitro formation of neuroclusters in microfluidic devices and cell migration as a function of stromal-derived growth factor 1 gradients. Cell Adh Migr. 2017;11:1–12. [DOI] [PubMed] [PMC]

20.

Pena CD, Zhang S, Majeska R, Venkatesh T, Vazquez M. Invertebrate Retinal Progenitors as Regenerative Models in a Microfluidic System. Cells. 2019;8:1301. [DOI] [PubMed] [PMC]

21.

Schnichels S, Paquet-Durand F, Löscher M, Tsai T, Hurst J, Joachim SC, et al. Retina in a dish: Cell cultures, retinal explants and animal models for common diseases of the retina. Prog Retin Eye Res. 2021;81:100880. [DOI] [PubMed]

22.

Liu YV, Sodhi SK, Xue G, Teng D, Agakishiev D, McNally MM, et al. Quantifiable In Vivo Imaging Biomarkers of Retinal Regeneration by Photoreceptor Cell Transplantation. Transl Vis Sci Technol. 2020;9:5. [DOI] [PubMed] [PMC]

23.

Peña JS, Vazquez M. Harnessing the Neuroprotective Behaviors of Müller Glia for Retinal Repair. Front Biosci (Landmark Ed). 2022;27:169. [DOI] [PubMed] [PMC]

24.

Yadav VK, Rana J, Singh A, Singh KJ, Kumar S, Singh S. Evaluation of ganglion cell-inner plexiform layer thickness in the diagnosis of pre-perimetric glaucoma and comparison to retinal nerve fiber layers. Indian J Ophthalmol. 2024;72:357–62. [DOI] [PubMed] [PMC]

25.

Vazquez M. Microfluidic and Microscale Assays to Examine Regenerative Strategies in the Neuro Retina. Micromachines (Basel). 2020;11:1089. [DOI] [PubMed] [PMC]

26.

Behtaj S, Öchsner A, Anissimov YG, Rybachuk M. Retinal Tissue Bioengineering, Materials and Methods for the Treatment of Glaucoma. Tissue Eng Regen Med. 2020;17:253–69. [DOI] [PubMed] [PMC]

27.

Ladero M, Reche-Sainz JA, Gallardo ME. Hereditary Optic Neuropathies: A Systematic Review on the Interplay between Biomaterials and Induced Pluripotent Stem Cells. Bioengineering (Basel). 2024;11:52. [DOI] [PubMed] [PMC]

28.

Austin CA, Lee KC, Swan RL, Khazeem MM, Manville CM, Cridland P, et al. TOP2B: The First Thirty Years. Int J Mol Sci. 2018;19:2765. [DOI] [PubMed] [PMC]

29.

Lyu YL, Lin C, Azarova AM, Cai L, Wang JC, Liu LF. Role of topoisomerase IIbeta in the expression of developmentally regulated genes. Mol Cell Biol. 2006;26:7929–41. [DOI] [PubMed] [PMC]

30.

Lyu YL, Wang JC. Aberrant lamination in the cerebral cortex of mouse embryos lacking DNA topoisomerase IIbeta. Proc Natl Acad Sci U S A. 2003;100:7123–8. [DOI] [PubMed] [PMC]

31.

Edmond M, Hanley O, Philippidou P. Topoisomerase IIβ Selectively Regulates Motor Neuron Identity and Peripheral Connectivity through Hox/Pbx-Dependent Transcriptional Programs. eNeuro. 2017;4:ENEURO.0404–17.2017. [DOI] [PubMed] [PMC]

32.

Bhanothu V, Kondapi AK. Status of topoisomerase-2β protein in all-trans retinoic acid-treated human neuroblastoma (SK-N-SH) cells. J Cell Biochem. 2019;120:5169–82. [DOI] [PubMed]

33.

Li Y, Hao H, Tzatzalos E, Lin R, Doh S, Liu LF, et al. Topoisomerase IIbeta is required for proper retinal development and survival of postmitotic cells. Biol Open. 2014;3:172–84. [DOI] [PubMed] [PMC]

34.

Li Y, Hao H, Swerdel MR, Cho H, Lee K, Hart RP, et al. Top2b is involved in the formation of outer segment and synapse during late-stage photoreceptor differentiation by controlling key genes of photoreceptor transcriptional regulatory network. J Neurosci Res. 2017;95:1951–64. [DOI] [PubMed] [PMC]

35.

Doh ST, Hao H, Loh SC, Patel T, Tawil HY, Chen DK, et al. Analysis of retinal cell development in chick embryo by immunohistochemistry and in ovo electroporation techniques. BMC Dev Biol. 2010;10:8. [DOI] [PubMed] [PMC]

36.

Islam MM, Doh ST, Cai L. In ovo electroporation in embryonic chick retina. J Vis Exp. 2012;3792. [DOI] [PubMed] [PMC]

37.

Grauslund M, Thougaard AV, Füchtbauer A, Hofland KF, Hjorth PH, Jensen PB, et al. A mouse model for studying the interaction of bisdioxopiperazines with topoisomerase IIalpha in vivo. Mol Pharmacol. 2007;72:1003–14. [DOI] [PubMed]

38.

Giménez-Abián JF, Lane AB, Clarke DJ. Analyzing Mitotic Chromosome Structural Defects After Topoisomerase II Inhibition or Mutation. Methods Mol Biol. 2018;1703:191–215. [DOI] [PubMed]

39.

Jirkovská A, Karabanovich G, Kubeš J, Skalická V, Melnikova I, Korábečný J, et al. Structure-Activity Relationship Study of Dexrazoxane Analogues Reveals ICRF-193 as the Most Potent Bisdioxopiperazine against Anthracycline Toxicity to Cardiomyocytes Due to Its Strong Topoisomerase IIβ Interactions. J Med Chem. 2021;64:3997–4019. [DOI] [PubMed]

40.

Heng X, Jin G, Zhang X, Yang D, Zhu M, Fu S, et al. Nurr1 regulates Top IIβ and functions in axon genesis of mesencephalic dopaminergic neurons. Mol Neurodegener. 2012;7:4. [DOI] [PubMed] [PMC]

41.

Harkin LF, Gerrelli D, Diaz DCG, Santos C, Alzu’bi A, Austin CA, et al. Distinct expression patterns for type II topoisomerases IIA and IIB in the early foetal human telencephalon. J Anat. 2016;228:452–63. [DOI] [PubMed] [PMC]

42.

Nur-E-Kamal A, Meiners S, Ahmed I, Azarova A, Lin C, Lyu YL, et al. Role of DNA topoisomerase IIbeta in neurite outgrowth. Brain Res. 2007;1154:50–60. [DOI] [PubMed]

43.

Tsutsui K, Sano K, Kikuchi A, Tokunaga A. Involvement of DNA topoisomerase IIbeta in neuronal differentiation. J Biol Chem. 2001;276:5769–78. [DOI] [PubMed]

44.

Comelles J, Castillo-Fernández Ó, Martínez E. How to Get Away with Gradients. Adv Exp Med Biol. 2022;1379:31–54. [DOI] [PubMed]

45.

Wakula M, Balcerak A, Smietanka U, Chmielarczyk M, Konopiński R, Grzybowska EA. Quantification of Cell-Substrate Adhesion Area and Cell Shape Distributions in MCF7 Cell Monolayers. J Vis Exp. 2020;e61461. [DOI] [PubMed]

46.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–8. [DOI] [PubMed]

47.

Vergara MN, Canto-Soler MV. Rediscovering the chick embryo as a model to study retinal development. Neural Dev. 2012;7:22. [DOI] [PubMed] [PMC]

48.

Huang KC, Gao H, Yamasaki EF, Grabowski DR, Liu S, Shen LL, et al. Topoisomerase II poisoning by ICRF-193. J Biol Chem. 2001;276:44488–94. [DOI] [PubMed]

49.

Caccamo D, Katsetos CD, Herman MM, Frankfurter A, Collins VP, Rubinstein LJ. Immunohistochemistry of a spontaneous murine ovarian teratoma with neuroepithelial differentiation. Neuron-associated beta-tubulin as a marker for primitive neuroepithelium. Lab Invest. 1989;60:390–8. [PubMed]

50.

Weishaupt JH, Klöcker N, Bähr M. Axotomy-induced early down-regulation of POU-IV class transcription factors Brn-3a and Brn-3b in retinal ganglion cells. J Mol Neurosci. 2005;26:17–25. [DOI] [PubMed]

51.

Liu W, Khare SL, Liang X, Peters MA, Liu X, Cepko CL, et al. All Brn3 genes can promote retinal ganglion cell differentiation in the chick. Development. 2000;127:3237–47. [DOI] [PubMed]

52.

Rogers JH. Two calcium-binding proteins mark many chick sensory neurons. Neuroscience. 1989;31:697–709. [DOI] [PubMed]

53.

Araki CM, Pires RS, Britto LR, Lindstrom JM, Karten HJ, Hamassaki-Britto DE. Differential co-localization of nicotinic acetylcholine receptor subunits with calcium-binding proteins in retinal ganglion cells. Brain Res. 1997;774:250–5. [DOI] [PubMed]

54.

Roy P, Bandyopadhyay A. Spatio-temporally restricted expression of cell adhesion molecules during chicken embryonic development. PLoS One. 2014;9:e96837. [DOI] [PubMed] [PMC]

55.

Seigel GM. Review: R28 retinal precursor cells: the first 20 years. Mol Vis. 2014;20:301–6. [PubMed] [PMC]

56.

Treharne AJ, Grossel MC, Lotery AJ, Thomson HA. The chemistry of retinal transplantation: the influence of polymer scaffold properties on retinal cell adhesion and control. Br J Ophthalmol. 2011;95:768–73. [DOI] [PubMed]

57.

Higuchi A, Kumar SS, Benelli G, Alarfaj AA, Munusamy MA, Umezawa A, et al. Stem Cell Therapies for Reversing Vision Loss. Trends Biotechnol. 2017;35:1102–17. [DOI] [PubMed]

58.

Tong J, Qi Y, Wang X, Yu L, Su C, Xie W, et al. Cell micropatterning reveals the modulatory effect of cell shape on proliferation through intracellular calcium transients. Biochim Biophys Acta Mol Cell Res. 2017;1864:2389–401. [DOI] [PubMed]

59.

Sluch VM, Chamling X, Liu MM, Berlinicke CA, Cheng J, Mitchell KL, et al. Enhanced Stem Cell Differentiation and Immunopurification of Genome Engineered Human Retinal Ganglion Cells. Stem Cells Transl Med. 2017;6:1972–86. [DOI] [PubMed] [PMC]

60.

Yang X, Li W, Prescott ED, Burden SJ, Wang JC. DNA topoisomerase IIbeta and neural development. Science. 2000;287:131–4. [DOI] [PubMed]

61.

Nevin LM, Xiao T, Staub W, Baier H. Topoisomerase IIbeta is required for lamina-specific targeting of retinal ganglion cell axons and dendrites. Development. 2011;138:2457–65. [DOI] [PubMed] [PMC]

62.

Hossain MS, Akimitsu N, Takaki T, Hirai H, Sekimizu K. ICRF-193, a catalytic inhibitor of DNA topoisomerase II, inhibits re-entry into the cell division cycle from quiescent state in mammalian cells. Genes Cells. 2002;7:285–94. [DOI] [PubMed]

63.

Nakazawa N, Mehrotra R, Arakawa O, Yanagida M. ICRF-193, an anticancer topoisomerase II inhibitor, induces arched telophase spindles that snap, leading to a ploidy increase in fission yeast. Genes Cells. 2016;21:978–93. [DOI] [PubMed]

64.

Eiraku M, Takata N, Ishibashi H, Kawada M, Sakakura E, Okuda S, et al. Self-organizing optic-cup morphogenesis in three-dimensional culture. Nature. 2011;472:51–6. [DOI] [PubMed]

65.

Li G, Luo Y. Enriching new transplantable RGC-like cells from retinal organoids for RGC replacement therapy. Biochem Biophys Res Commun. 2024;700:149509. [DOI] [PubMed]

66.

O’Hara-Wright M, Gonzalez-Cordero A. Retinal organoids: a window into human retinal development. Development. 2020;147:dev189746. [DOI] [PubMed] [PMC]

67.

Roll L, Faissner A. Influence of the extracellular matrix on endogenous and transplanted stem cells after brain damage. Front Cell Neurosci. 2014;8:219. [DOI] [PubMed] [PMC]

68.

Chen T, She P, Chen DF, Lu J, Yang C, Huang D, et al. Polybenzyl Glutamate Biocompatible Scaffold Promotes the Efficiency of Retinal Differentiation toward Retinal Ganglion Cell Lineage from Human-Induced Pluripotent Stem Cells. Int J Mol Sci. 2019;20:178. [DOI] [PubMed] [PMC]

69.

Lee H, Mood K, Battu G, Ji YJ, Singh A, Daar IO. Fibroblast growth factor receptor-induced phosphorylation of ephrinB1 modulates its interaction with Dishevelled. Mol Biol Cell. 2009;20:124–33. [DOI] [PubMed] [PMC]

70.

Unachukwu UJ, Warren A, Li Z, Mishra S, Zhou J, Sauane M, et al. Predicted molecular signaling guiding photoreceptor cell migration following transplantation into damaged retina. Sci Rep. 2016;6:22392. [DOI] [PubMed] [PMC]

71.

Markey MW, Pena CD, Venkatesh T, Cai L, Vazquez M. Retinal Progenitor Cells Exhibit Cadherin-Dependent Chemotaxis across Transplantable Extracellular Matrix of In Vitro Developmental and Adult Models. J Tissue Eng Regener Med. 2023;2023:1381620. [DOI]