Primers used in the study.
| Primer name | Forward (F) | Reverse (R) | Annealing temperature |
|---|---|---|---|
| Caspase 3(Casp3) | 5’GGAGCTTGGAACGCGAAGAA3’ | 3’ACACAAGCCCATTTCAGGGT5’ | 53.8°C for 10 s |
| RAGE(Ager) | 5’GGGTCACAGAAACCGGTGAT3’ | 3’ATCATGTGGGCTCTGGTTGG5’ | 57°C for 10 s |
| PGC-1α(Ppargc1a) | 5’CCAAAGCTGAAGCCCTCTTGC3’ | 3’GTTTAGTCTTCCTTTCCTCGTGTC5’ | 63°C for 30 s |
The authors would like to acknowledge Ms. Aayushi Trivedi, Ms. Priyanka Kashyap, and Mr. Pravin Salunkhe for their assistance in the experiment.
SB: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing—original draft, Writing—review & editing. SM: Writing—review & editing, Methodology, Investigation. VP: Writing—review & editing, Methodology, Investigation. AK: Writing—review & editing, Methodology, Investigation. VD: Writing—review & editing, Resources, Methodology, Investigation. SS: Writing—review & editing, Supervision, Resources, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. All authors have read and have approved the submitted version.
The authors declare that they have no conflicts of interest.
The entire animal study was carried out according to a protocol approved by the Committee for the Purpose of Control and Supervision on Experiments on Animals (CPCSEA), India-registered Institutional Animal Ethics Committee (IAEC). The procedures followed for the animal study complied with the Guide for the Care and Use of Laboratory Animals. The approved protocol number is ICT/IAEC/2017/P26.
Not applicable.
Not applicable.
The datasets that support the findings of this study are available from the corresponding author upon reasonable request.
This work was supported by the University Grants Commission Basic Science Research (UGC-BSR) Fellowship [F.25-1/2014-15 (BSR)/No. F.5-63/2007 (BSR)]. The authors would like to declare that the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
© The Author(s) 2025.
Open Exploration maintains a neutral stance on jurisdictional claims in published institutional affiliations and maps. All opinions expressed in this article are the personal views of the author(s) and do not represent the stance of the editorial team or the publisher.