Primer sequences for XPO1 qPCR
| Primer | Forward | Probe | Reverse |
|---|---|---|---|
| XPO1 wild type | GCATCAAATATCATGTACATAG | FAM-CAGAAATT(RTQ1)TCCAGTGAGCTCTCA-P | GAGATTTACCATGCATGAATTC |
| XPO1-E571K/E571G | GCATCAAATATCATGTACATAG | FAM-CAGAAATT(RTQ1)TCCAGTGAGCTCTCA-P | GAGATTTACCATGCATGAATTK※ |
※ K (G or T) (https://www.bioinformatics.org/sms/iupac.html). XPO1: exportin 1; qPCR: quantitative polymerase chain reaction
YKM: Conceptualization, Project administration, Data curation, Writing—review & editing. RRA: Investigation, Writing—original draft, Formal analysis, Visualization. NVR: Conceptualization, Investigation, Project administration, Data curation, Methodology, Resources, Writing—review & editing. BVB: Investigation, Data curation, Writing—review & editing. TVA: Investigation, Data curation, Writing—original draft. VLS: Methodology, Resources. IAS: Investigation, Data curation. TNO: Conceptualization, Writing—review & editing, Resources. RII: Investigation, Data curation, Writing—original draft. YAC: Methodology, Formal analysis, Visualization. AUM: Conceptualization. LEN: Investigation. SMK: Methodology, Formal analysis, Visualization. EEZ: Conceptualization. AMK: Conceptualization, Writing—review & editing, Resources. ABS: Conceptualization, Writing—review & editing, Supervision. All authors read and approved the submitted version.
The authors declare that they have no conflicts of interest.
The present study has been accepted by the institutional ethical committee (National Medical Research Center for Hematology, Moscow, Russian Federation, protocol #165/30.06.2022). At this committee, we have approved the use of retrospective data from patients who received treatment before 2022 for our study. For patients who were included in the study and received treatment between 2007 and 2013, the study was conducted in accordance with the Helsinki Declaration of 1975, revised in 2008. As for the patients who received treatment after 2013, the study was conducted in accordance with the Helsinki Declaration of 1975, revised in 2013. All patients provided informed consent under National Medical Research Center for Hematology approved protocol allowing collection and analysis of data.
Informed consent to participate in the study was obtained from all participants.
Not applicable.
The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.
This study was supported by RAKFOND (THE FOUNDATION FOR CANCER RESEARCH SUPPORT, Russia) grant [2.2020]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
© The Author(s) 2025.
Open Exploration maintains a neutral stance on jurisdictional claims in published institutional affiliations and maps. All opinions expressed in this article are the personal views of the author(s) and do not represent the stance of the editorial team or the publisher.