Exploration of Targeted Anti-tumor Therapy

Gene	Forward primer sequence	Reverse primer sequence
GDF3	TGTCTGCCATCAAAGAAAGGGAAC	GGGACTGACCGCAACACAAAC
GAPDH	GGAAGGTGAAGGTCGGAGTCA	GTCATTGATGGCAACAATATCCACT

Declarations

Author contributions

STM: Data curation, Formal analysis, Investigation, Writing—original draft. MMF: Conceptualization, Validation, Writing—review & editing, Supervision.

Conflicts of interest

The authors declare that they have no conflicts of interest.

Ethical approval

All procedures performed in studies involving human participants were in accordance with the ethical standards of the Mashhad University of Medical Sciences (protocol number of the Ethical committee: 88098) and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

Consent to participate

Informed consent to participate in the study was obtained from all participants.

Consent to publication

Not applicable.

Availability of data and materials

Not applicable.

Funding

Not applicable.

Copyright

References

Harirchi I, Kolahdoozan S, Hajizadeh S, Safari F, Nahvijou A, Mir MR, et al. Esophageal cancer in Iran; a population-based study regarding adequacy of cancer surgery and overall survival. Eur J Surg Oncol. 2014;40:352–7. [DOI] [PubMed]

Etemadi A, Abnet CC, Golozar A, Malekzadeh R, Dawsey SM. Modeling the risk of esophageal squamous cell carcinoma and squamous dysplasia in a high risk area in Iran. Arch Iran Med. 2012;15:18–21. [PubMed] [PMC]

Gholamin M, Moaven O, Memar B, Farshchian M, Naseh H, Malekzadeh R, et al. Overexpression and interactions of interleukin-10, transforming growth factor β, and vascular endothelial growth factor in esophageal squamous cell carcinoma. World J Surg. 2009;33:1439–45. [DOI] [PubMed]

Kamangar F, Malekzadeh R, Dawsey SM, Saidi F. Esophageal cancer in northeastern Iran: a review. Arch Iran Med. 2007;10:70–82. [PubMed]

Hu Y, Fu L. Targeting cancer stem cells: a new therapy to cure cancer patients. Am J Cancer Res. 2012;2:340–56. [PubMed] [PMC]

Gil J, Stembalska A, Pesz KA, Sąsiadek MM. Cancer stem cells: the theory and perspectives in cancer therapy. J Appl Genet. 2008;49:193–9. [DOI] [PubMed]

Rahman M, Deleyrolle L, Vedam-Mai V, Azari H, Abd-El-Barr M, Reynolds BA. The cancer stem cell hypothesis: failures and pitfalls. Neurosurgery. 2011;68:531–45. [DOI] [PubMed]

Heldin CH, Miyazono K, ten Dijke P. TGF-β signalling from cell membrane to nucleus through SMAD proteins. Nature. 1997;390:465–71. [DOI] [PubMed]

Levine AJ, Brivanlou AH. GDF3 at the crossroads of TGF-beta signaling. Cell Cycle. 2006;5:1069–73. [DOI] [PubMed]

10.

Levine AJ, Levine ZJ, Brivanlou AH. GDF3 is a BMP inhibitor that can activate nodal signaling only at very high doses. Dev Biol. 2009;325:43–8. [DOI] [PubMed] [PMC]

11.

Tykwinska K, Lauster R, Knaus P, Rosowski M. Growth and differentiation factor 3 induces expression of genes related to differentiation in a model of cancer stem cells and protects them from retinoic acid-induced apoptosis. PLoS One. 2013;8:e70612. [DOI] [PubMed] [PMC]

12.

Levine AJ, Brivanlou AH. GDF3, a BMP inhibitor, regulates cell fate in stem cells and early embryos. Development. 2006;133:209–16. [DOI] [PubMed]

13.

Ehira N, Oshiumi H, Matsumoto M, Kondo T, Asaka M, Seya T. An embryo-specific expressing TGF-β family protein, growth-differentiation factor 3 (GDF3), augments progression of B16 melanoma. J Exp Clin Cancer Res. 2010;29:135. Erratum in: J Exp Clin Cancer Res. 2014;33:22. [DOI] [PubMed] [PMC]

14.

Clark AT, Rodriguez RT, Bodnar MS, Abeyta MJ, Cedars MI, Turek PJ, et al. Human STELLAR, NANOG, and GDF3 genes are expressed in pluripotent cells and map to chromosome 12p13, a hotspot for teratocarcinoma. Stem Cells. 2004;22:169–79. [DOI] [PubMed]

15.

Caricasole AA, van Schaik RH, Zeinstra LM, Wierikx CD, van Gurp RJ, van den Pol M, et al. Human growth-differentiation factor 3 (hGDF3): developmental regulation in human teratocarcinoma cell lines and expression in primary testicular germ cell tumours. Oncogene. 1998;16:95–103. [DOI] [PubMed]

16.

Ezeh UI, Turek PJ, Reijo RA, Clark AT. Human embryonic stem cell genes OCT4, NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma. Cancer. 2005;104:2255–65. [DOI] [PubMed]

17.

Li Q, Ling Y, Yu L. GDF3 inhibits the growth of breast cancer cells and promotes the apoptosis induced by Taxol. J Cancer Res Clin Oncol. 2012;138:1073–9. [DOI] [PubMed]

18.

Sobin LH, Gospodarowicz MK, Wittekind C. TNM classification of malignant tumours. 7th ed. Wiley: London; 2009.

19.

Moghbeli M, Forghanifard MM, Aarabi A, Mansourian A, Abbaszadegan MR. Clinicopathological sex- related relevance of musashi1 mRNA expression in esophageal squamous cell carcinoma patients. Pathol Oncol Res. 2014;20:427–33. [DOI] [PubMed]

20.

Rubie C, Kempf K, Hans J, Su J, Tilton B, Georg T, et al. Housekeeping gene variability in normal and cancerous colorectal, pancreatic, esophageal, gastric and hepatic tissues. Mol Cell Probes. 2005;19:101–9. [DOI] [PubMed]

21.

Guan X, Zhong X, Men W, Gong S, Zhang L, Han Y. Analysis of EHMT1 expression and its correlations with clinical significance in esophageal squamous cell cancer. Mol Clin Oncol. 2014;2:76–80. [DOI] [PubMed] [PMC]

22.

Forghanifard MM, Gholamin M, Moaven O, Farshchian M, Ghahraman M, Aledavood A, et al. Neoantigen in esophageal squamous cell carcinoma for dendritic cell-based cancer vaccine development. Med Oncol. 2014;31:191. [DOI] [PubMed]

23.

Moghbeli M, Moghbeli F, Forghanifard MM, Abbaszadegan MR. Cancer stem cell detection and isolation. Med Oncol. 2014;31:69. [DOI] [PubMed]

24.

Li Q, Liu X, Wu Y, An J, Hexige S, Ling Y, et al. The conditioned medium from a stable human GDF3-expressing CHO cell line, induces the differentiation of PC12 cells. Mol Cell Biochem. 2012;359:115–23. [DOI] [PubMed]

25.

Finicelli M, Benedetti G, Squillaro T, Pistilli B, Marcellusi A, Mariani P, et al. Expression of stemness genes in primary breast cancer tissues: the role of SOX2 as a prognostic marker for detection of early recurrence. Oncotarget. 2014;5:9678–88. [DOI] [PubMed] [PMC]

26.

Willem P. Mechanisms of cancer initiation/progression: an investigation of chromosomal “hot spots” in South African cancer patients [dissertation]. University of the Witwatersrand; 2008.

27.

Levasseur DN, Wang J, Dorschner MO, Stamatoyannopoulos JA, Orkin SH. Oct4 dependence of chromatin structure within the extended Nanog locus in ES cells. Genes Dev. 2008;22:575–80. [DOI] [PubMed] [PMC]

28.

Park SW, Lim HY, Do HJ, Sung B, Huh SH, Uhm SJ, et al. Regulation of human growth and differentiation factor 3 gene expression by NANOG in human embryonic carcinoma NCCIT cells. FEBS Lett. 2012;586:3529–35. [DOI] [PubMed]

29.

Moghbeli M, Abbaszadegan MR, Farshchian M, Montazer M, Raeisossadati R, Abdollahi A, et al. Association of PYGO2 and EGFR in esophageal squamous cell carcinoma. Med Oncol. 2013;30:516. [DOI] [PubMed]

30.

Forghanifard MM, Ardalan Khales S, Javdani-Mallak A, Rad A, Farshchian M, Abbaszadegan MR. Stemness state regulators SALL4 and SOX2 are involved in progression and invasiveness of esophageal squamous cell carcinoma. Med Oncol. 2004;31:922. [DOI] [PubMed]